Biblically Relevant News - Most of it is these days!
|
THE APPOINTED TIMES |
|
On February 23 the Daily Mail ran an article showing that Moderna had cited in several patent applications, the precise 19 base letter (nucleotide) sequence which codes for the Furin Cleavage site in Covid-19.
They cited a Paper by Scientists in India, Switzerland, Italy and the US (cautiously entitled: MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site) in which they calculated that the chances of a 19 nucleotide sequence patented by Moderna randomly appearing in Covid-19 in circumstances where it does not appear anywhere else in nature are 1 in 3 trillion. But they failed to make the obvious deduction there from. Had they made said obvious deduction I fear that might have been the last scientific deduction they ever got published!
They decided to investigate the RNA sequence for the Furin cleavage site in the Covid-19 Spike Protein to see if it occurred anywhere else in nature. .
Fortunately the NCBI/NIH have produced the wonderful BLAST database which catalogues every gene sequence in nature known to man and every synthetic patented gene sequence known to the patent office.
The researchers chose the Furin Cleavage sequence because it is the only continuous gene letter sequence (nucleotide sequence) in Covid-19 with more than 3 nucleotides, that differs from the respective letters in its closest natural relative the Bat Coronavirus RaTG13 (all other differences are 3 letters or less long). So it was by far the best candidate for determining whether or not Covid-19 was man made.
The reader might consider it more likely that a Furin Cleavage Site would appear in the Sun than in the Daily Mail. But this cleavage refers to the separation of spike from virus rather than pillow from pillow.
Furthermore the Furin Cleavage Site is key to the pathogenicity of Covid-19. So if there was to be some man made gain of function included in the virus, this is where one might expect to find it.
The Amino Acid sequence of the Furin Cleavage Site is PRRA (Proline Arginine Arginine Alanine). Each Amino Acid is coded for by a Codon, consisting of 3 nucleotides (genetic sequence letters). So all the differences in the genetic code between Covid-19 and RaTG13 are at most one Codon long, one amino acid long, other than the Furin Cleavage Sequence, which is...
CCT CGG CGG GCA
The complimentary sequence (the opposing DNA strand of the double helix is (GGAGCCGCCCGT) because C binds with G and A binds with T
The reverse compliment (the same thing written backwards) is therefore TGCCCGCCGAGG
The researchers did a BLAST (Basic Local Alignment Search Tool) alignment search (which means they search for the gene sequence, the reverse gene sequence, the complimentary gene sequence and the reverse complimentary gene sequence) through every gene sequence in nature known to man for CTCCTCGGCGGGCACGTAG which is the 19 nucleotide sequence containing the Furin Cleavage Sequence, which also appears in Covid-19, and which is found actually in the reverse compliment form CTACGTGCCCGCCGAGGAG cited in Moderna Patents.
Their search results can be found here.
Table 1 shows that it does exist in the 5 US patents cited below...
US9149506B2: Modified polynucleotides encoding septin-4 - https://patents.google.com/patent/US9149506B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618953P
2013-12-16 Application filed by Moderna Therapeutics Inc
2014-05-22 Publication of US20140141067A1
2015-10-06 Publication of US9149506B2
2015-10-06 Application granted
2020-01-10 First worldwide family litigation filed
US9216205B2: Modified polynucleotides encoding granulysin - https://patents.google.com/patent/US9216205B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618873P
2013-12-16 Application filed by Moderna Therapeutics Inc
2014-04-24 Publication of US20140113960A1
2015-12-22 Publication of US9216205B2
2015-12-22 Application granted
US9255129B2: Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
- https://patents.google.com/patent/US9255129B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618868P
2013-12-16 Application filed by Moderna Therapeutics Inc
2014-05-22 Publication of US20140141068A1
2016-02-09 Application granted
2016-02-09 Publication of US9255129B2
US9301993B2: Modified polynucleotides encoding apoptosis inducing factor 1
- https://patents.google.com/patent/US9301993B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618957P
2013-12-16 Application filed by Moderna Therapeutics Inc
2014-04-17 Publication of US20140107189A1
2016-04-05 Application granted
2016-04-05 Publication of US9301993B2
2020-01-10 First worldwide family litigation filed
US9587003B2: Modified polynucleotides for the production of oncology-related proteins and peptides
- https://patents.google.com/patent/US9587003B2/en
Inventor: Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618868P
2016-02-04 Application filed by ModernaTx Inc
2016-06-02 Publication of US20160152678A1
2017-03-07 Publication of US9587003B2
2017-03-07 Application granted
So Moderna first applied for a patent citing the 19 nucleotide sequence in 2013 on December 16. Perhaps December25 would have been more appropriate since it was destined to become the Crown of Thorns of Mathew27, Mark15 and John19
Table2: Shows that the sequence occurs in Covid-19 from nucleotide 23601 to 23619.
Table3: Shows that this gene sequence does not exist in nature (but 14 nucleotide parts of it do).
I decided to check their work. Yes. I fact checked them (I will send an invoice to the globalists). This turned out to be a bit of an epic journey. The Google patent page for US9587003B2 does not contain the gene sequence. The pdf of the patent does not contain the gene sequence and is not searchable from pages 101-304. But it does have a link to a lengthy 'Sequence Listing" section which link one cannot copy. So I manually transcribed it in my fair hand - http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2
From that page you can enter the Sequence ID quoted in the paper as 11652 and get to https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 which has the following at Nucleotides 2751-2733 reading backwards...
gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc 2760
CTACGTGCCCGCCGAGGAG cited in Moderna's patents is the reverse compliment of CTCCTCGGCGGGCACGTAG, the 19 nucleotide sequence which appears in Covid-19 DNA from nucleotide 23601-23619 (which would therefore be covered by their patent).
Likewise you can search for the sequence in US9149506B2 by going to https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652, whereupon you will find the same thing again
gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc 2760
I then searched the gene sequence of Wuhan Hu1 (alpha) at https://www.ncbi.nlm.nih.gov/nuccore/NC_045512 and found
23581 ttatcagact cagactaatt ctcctcggcg ggcacgtagt gtagctagtc aatccatcat from https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
Which has the 19 nucleotide sequence CTCCTCGGCGGGCACGTAG from 23601-23619 as described in table 3.
I then ran my own non aligned blast search of all patented gene sequences for the reverse compliment directly (or perhaps for a back handed compliment) and got the same results as the researchers
And the same for the other 3 US patents.
So I can confirm, and the reader can confirm using the links above, that Moderna did apply for a Patent not only citing the reverse compliment of the 12 nucleotide Furin Cleavage Site in Covid-19 but actually citing the 19 nucleotide sequence containing it as described above. Furthermore they did not merely apply for a patent on 2016 February 4 with US9587003B2: as reported in the Daily Mail. They actually applied on 2013 December 16 for 4 patents with US9149506B2, US9216205B2, US9255129B2, US9301993B2:as well.
So Moderna had developed, or had knowledge of, the 19 nucleotide gene sequence containing the Furin Cleavage Site which gives Covid19 its infectivity to humans by patented gain of function research as early as 2013, 6 years before the Wuhan outbreak took place. Not 3 as reported in the Mail and virally elsewhere. But the bat coronavirus RaTG13 from which Covid19 was derived was also discovered in 2013. Well, what a coincidence!
So now we look at the chances of this occurring naturally. The paper calculates the probability of this particular 19 nucleotide sequence occurring randomly in a 30,000 nucleotide virus as
(30,000-18) x (1/4)19 = 1.09 x 10-7
Which is correct because there are 30,000-18 places to start the sequence given that it needs a further 18 more letters to complete it. But there are actually 29,904 nucleotides in Wuhan HU1 (alpha). So a more accurate calculation would be
(29,904-18) x (1/4)19 = 1.087 x 10-7
Then they calculate the chances that the 19 nucleotide sequence occurs in the patented library of 24,712 sequences with a mean length of 3300 nucleotides. But that calculation is irrelevant because the sequence did not randomly appear in 5 Moderna Patent applications. The sequence was known to code for a Furin Cleavage Site, which is known to provide gain of function to Coronaviruses. It was put there deliberately and patented due to its infecting power in humans, which we shall see, later in the article, results from the normal viral Arginine (R) codon AGA (used in 45% of viral Arginine codons) being replaced by the human Arginine codon CGG (used in 0% of viral Arginine codons) in the furin cleavage site.
All we are trying to work out here is what the chances are of a 19 nucleotide sequence patented by Moderna turning up in Covid-19 through natural causes, the natural mutations of Bat Coronavirus RaTG13 or some other virus.
The nucleotides form Codons which are triplets. So there are 64 possible triplets of the 4 DNA nucleotides ACGT (4x4x4 = 64). But all triplets do occur. 61 code for 20 amino acids redundantly and 3 are stop codons which tell the ribosome to stop making the protein.
But things are not this simple because the Furin cleavage site appears in the spike protein where it needs to be and the spike protein only has 1273x3 = 3819 nucleotides. The chances of the 19 nucleotide Furin Cleavage sequence appearing in the spike protein are
(3,819-18) x (1/4)19 = 1.389 x 10-8
Or 1 in 72 million. So those would be the chances that one particular variant, say the first Covid-19 variant, had the 19 nucleotide sequence in the right place (the spike). And it did. So certainly by the balance of probabilities, and certainly beyond a reasonable doubt (1.4 in one hundred million being an unreasonable doubt) Moderna was involved in the making of Covid-19.
Prof Luc Montagnier, before he died on 2022February8, did a total assassination of the concept that Covid-19 evolved naturally by showing that it had massive equivalence to HIV. The diagram below shows a 275 nucleotide region of Covid-19 which has 200 nucleotides from HIV/SIV (Simian ImmunoVirus) in it. And remember there are 61 codons specifying 20 amino acids. So one can say the same thing in on average 3 different ways with codons. You can download a pdf of his study here and the supplementary materials here. It is very technical. But he did win the Nobel prize for discovering the HIV virus. So if anyone would know if Covid had been boosted with HIV, it would be him. He pointed out that Covid-19 was man made early in the pandemic and was himself assassinated by the press and the fact checkers as a result. Every single fact checker who attacked him was wrong. There was no scientific basis to any of their fact checking. These outfits are not fact checkers at all of course. They are globalist disinformation agencies, sons of Goebbels, fact chuckers and science deniers. They are about as trustworthy as an American election. I can check a fact for myself thank you very much. I don't need a brainwashed woke madrassa student telling me their opinion about a subject that they never studied at University.
Since we have proven beyond a reasonable doubt (beyond a 1 in 72 million doubt statically and with 100% certainly biochemically from the Moderna Specific Furin Cleavage Site) that Moderna made Covid-19. And since Moderna and Fauci have not admitted to having made it and have in fact covered up evidence to that effect, it may be the case that they are hiding something else as well. Because the only two theories now left are the accidental lab leak theory and the deliberate lab leak theory. I mean the vast majority of political leaks are not accidents. They are deliberate strategies to provide advantage to the leaker or his paymaster. It is well known in the IT industry that viruses appear when antivirus sales are needed. Why would things be any different with human viruses, now that they can be man made too? Especially when you consider the massive role of Bill Gates and his foundation and GAVI and GVAP in he global vaccination business.
The only reason that Moderna would make Covid-19 is to release it. Otherwise the entire exercise would be financially futile, commercially futile
The reason adduced by Fauci for doing gain of function research is that man needs to be ahead of nature or bad actors in order that they will have a vaccine in good time if a disease mutates or is genetically modified by the Chinese or the Russians to be lethal.
But in order to believe that one has to believe that Moderna are interested in the saving people's lives. I am sorry. All their actions show to me that they are interested in vaccinating people knowing how likely that is to cost them their lives.
They are interested in profit, the profit that comes from a pandemic. They are not our saviours as they represent. They are our abusers.
They produced the virus in order to leak it not in order to save mankind. They are not our saviours. Luc Montagnier was trying to be our saviour from them and he was assassinated (professionally) their groupies. Moderna were doing gain of function research in order to release the virus and force a vaccine for it in a manner which would maximise their profits. That is not a conspiracy theory. It is what happened precisely. Their share price went up by 20x.
They released it in order to sell their vaccines and to destroy the immune systems of their customers because our immune systems reduce their profits. That is the Pharma business.
The reason that the writer is so confident that Moderna or their agents made and leaked Covid-19 and the reason I called it as such at the start of the pandemic to almost as much ridicule as Prof Montagnier received (God bless him) is that the scriptures say in Matthew27, Mark15 and John19 that.
29 And they (the soldiers of the governor of verse 27)
platted a crown of thorns and put it upon his head, and a reed in his right
hand; and they kneeled down before him, and mocked him, saying, Hail, King of
the Jews!
30 And they spat upon him, and took the reed and smote him
on the head. (Matthew 27 ASV)
May I therefore beg your indulgence whilst I interpret these words:
The US department of defence funded the gene splicing of the Coronavirus of Spike Proteins (Covid-19) through NIH and NIAID and DARPA which first infected Jesus, through his fiance, the New Covenant Saints, just after he became the secular King, Caesar to those saints, the antitypical Jews, those covenanted to be angelic sons of Jacob, the born agains angelically. We calculated that the malediction which prevented Jesus becoming Caesar to the saints ended in 2019Tishri15 (October17/18). Glenn Beck did a documentary showing that 10 hospitals in Wuhan took cases with Covid19 symptoms in October 2019. Yes Folks. Covid-19 is a proof that Jesus is now secular King over the saints, the antitypical Jews, the Jews by angelic salvation covenant, at the least. [Ed but only those who have died in their human bodies by Passover execution and been resurrected into the ark, that is the 1NCs and the HLCs of the 3rd Holy Spirit. He does not become Caesar to Abraham until 2022Chislev5 and Adam until 2022Chislev6 and Isaac until 2022Tebbeth5 and Cain until 2022Tebbeth11].
But then the soldiers spat upon him. For that is how Covid19 is transferred, through small aerosol droplets exhaled out of the mouth. The soldiers deliberately spat upon him. It was not a SALIVA LEAK! They smote Jesus on the head because the saints are the head of the church and they caught Covid19 not by random chance infection but by a deliberate smiting with a read, a biological weapon, a deliberate weaponised attack. For more on this see here.
So what Prof Montagnier saw with his virology expertise, I saw with my theological expertise. Showing that whilst fact checkers and science are mutually exclusive, science and theology actually agree, when properly understood (and that is one big caveat). Prof M taught us that the vaccines cause the variants. Indeed basic virology forbids mass vaccination during a pandemic for that very reason. He said the the curve of deaths follows the curve of vaccinations. Mind you, paradoxically, if the vaccines caused Omicron, then they saved us from themselves!
So why did Prof Montagnier choose to spend the last years of his life proving that Covid-19 was man made and that the spike proteins, and therefore the vaccines, were an existential threat to the species? What did he have left to prove to himself or to anybody else at 87-89? He certainly did not do it to increase his reputation in the profession. No he was driven by the same passion that drove him to discover HIV. A passion to SAVE mankind from viruses and those who would engineer them to damage us. And why did he give up the ghost in February 2022? Because he knew that Omicron had the vaccines beat. His job was done by a greater virologist even than him. He could therefore rest in peace and go see some people who understood the magnitude of his contribution.
Covid-19 was not made in 2019. It was made from the 19 nucleotide Moderna
specific chimeric (CGG for AGA) furin cleavage site which does not occur
anywhere in nature.
And every Covid death and every Covid vaccine death is parked squarely on their
doorstep waiting for justice. But they were only the front door, the shop front
for this deception. As we shall discover.
STEP 0: The genome, the complete genetic code of Covid19 is found here - https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2/ The genome of Bat Coronavirus RaTG13 is found here - https://www.ncbi.nlm.nih.gov/nuccore/MN996532
One can compare these two genomes, letter by letter using the BLAST Genome alignment comparison tool at https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC=align2seq
Just put NC_045512.2 in the Query Sequence Box and MN996532 in the Subject Sequence Box. Then choose the radio button:: More dissimilar sequences (discontinguous megablast). Then hit BLAST. Then when the results appear (a few seconds later) choose the Alignments tab and you will see both genomes compared perfectly. For the entire comparison see here
A is the base Adeninie
C is the base Cytosine
G is the base Gaumine
T is the base Thymine (not Thiamine which is a Vitamin added to Cornflakes)
The two genomes (full genetic codes) are 96% Identical. Here are all the differences...
There are 995 instances of a 1 letter mismatch
There are 24 instances of a 2 letter mismatch
There are 4 instances of a 3 letter mismatch
There are no further mismatches
There are 2 instances of a 1 letter omission at lines numbered 27341 and
29800.
There are 2 instances of a 2 letter omission at lines numbered 22981 and
23038
There are 2 instances of a 3 letter omission at lines numbered 3301 and 26504
There is one instance of a 12 letter omission at line numbered 23576
There are no further omissions.
Here are all the omissions
RatG13 3301 AGAGATGGAACCTACACCAGTTGTTCAGACT---GAAGTGAATAGCTTTAGTGGTTATTT 3357
Covid19 22981 TCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTC--CTTTA 23038
RatG13 23038 TA--GATATGGATTTTACCCTACTGATGGTGTTGGTCACCAACCTTATAGGGTAGTAGTA 23095
RatG13 23576 AGTTATCAGACTCAAACTAATT------------CACGTAGTGTGGCCAGTCAATCTATT 23623
RatG13 26504 AGCCATGGCAGAT---AACGGTACTATTACCGTTGAAGAGCTGAAAAAGCTCCTTGAACA 26560
RatG13 27341 ATGAAGAGCAACCAATGGAGATTGATT-AACGAACATGAAAATTATTCTTTTCTTGGTAC 27399
RatG13 29800 ATTTTAGTAGTGCTAT-CCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAA
29855
And that is it. There are no further differences. The overall match is 28723 letters out of 29877(96%). The total numbers of gap letters is 24 (12+3+3+2+2+1+1).
Natural mutations normally occur one letter at a time. So to determine whether or not Covid19 is man made we just have to look at the 12 letter gap, which is way too large for a series of random mutations that just happened to occur right next to each other in a 29877 letter genome, and all in the 6 years between 2013 (when RatG13 was sequenced) and 2019 when Covid-19 appeared, So the extra 12 letters, the extra 12 bases, the extra 12 nucleotides (base + sugar + phosphate) were inserted from another genome, either by nature or by man.
Covid19 23579 AGTTATCAGACTCAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATC 23638
|||||||||||||| |||||||
|||||||||| || |||||||| ||
RatG13 23576 AGTTATCAGACTCAAACTAATT------------CACGTAGTGTGGCCAGTCAATCTATT 23623
Each 3 letter group (called a codon) codes for one amino acid. So the inserted group in whole codons is actually...
TCT CCT CGG CGG GCA which codes for SPRRA (Serine, Proline, aRginine, aRginine, Alanine).
But the Furin Cleavage Site is PRRAR which includes the next Codon CGT which also codes for aRginine (R).
So the only difference between Covid-19 and RaTG13 which involves more than 3 nucleotides (more than one complete 3 letter Codon) is the Furin Cleavage Site which involves 12 nucleotides and parts of 5 Codons (15 nucleotides).
STEP 1: Run a BLAST virus search https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/ to see if this sequence (TCTCCTCGGCGGGCA) occurs in any virus in nature other than Covid19. Answer: It does not.
Search also for CTCCTCGGCGGGCA - Answer: It does not occur in any natural virus.. One cannot search just for the 12 letters CCTCGGCGGGCA because the search must have 14 letters minimum for some reason.
Search also for CCTCGGCGGGCACGT which codes for PRRAR, the famous Furin Cleavage site, which gives Covid-19 its gain of function infectivity - Answer: It does not occur in any natural virus.
STEP 2: Run a Patent BLAST (Basic Local Alignment Search Tool https://blast.ncbi.nlm.nih.gov/Blast.cgi chose Blastn and make sure 'align 2 or more sequences' is unchecked and chose patent sequences) search of every patent application for the 14 nucleotide sequence CTCCTCGGCGGGCA which is the 12 nucleotide insert plus the rest of the final 3 letter codon, the next two letters. We have to do this because the BLAST searches need a minimum of 14 letters. You cannot do a BLAST search for 12 nucleotides. In the Algorithm Parameters section set max targets to 5000.
Here are the results...
US5606032A: Process for preparing glial mitogenic factors
Description: The most disgusting imaginable method of obtaining a 745 base pair sequence of DNA from Bovine pituitary glands which has the wonderful capability of stimulating the division of rat
Schwann cells in when resident in fetal calf blood plasma.
Inventor: Andrew Goodearl, Paul Stroobant, Luisa Minghetti, Michael Waterfield, Mark
Marchioni, Mario S. Chen, Ian Hiles
Current Assignee: Ludwig Institute for Cancer Research Ltd, Acorda Therapeutics Inc
1991-04-10: Priority to GB919107566A
1995-06-06: Application filed by Ludwig Institute for Cancer Research Ltd, Cenes Pharmaceuticals Inc
1997-02-25: Application granted and published
2017-02-25: PATENT EXPIRED
So the first patented appearance of the 14 nucleotide insertion was in a 745 nucleotide sequence extracted from Cow's pituitary glands and published in 1997 at the beginning of the public internet!
US5958721A: Methods for screening of substances for therapeutic activity and yeast for use therein
Inventor: Christopher John Marshall, Alan Ashworth, David Anthony Hughes
1993-04-07: Priority to British Patent GB9307250
1994-03-31: Application filed by Cancer Research Campaign Technology Ltd
1999-09-28: Application granted and published
2099-09-28: PATENT EXPIRED
Description: Candidate pharmaceuticals for use in treatment of cancer, inflammatory disorders, cardio-vascular disorders or neurological disease. - Pretty much all the side effects of mRNA vaccines !
They used the mammalian MAPKK (Mitogen Activated Protein Kinase Kinase) gene sequence (containing the 14 nucleotide insert sequence) in yeast to screen for anti cancer capability. They did not use it in a virus.
US6074828A: Amino acid transporters and uses
Description: DNA encoding human amino acid transporters.
Inventor: Susan G. Amara, Jeffrey L. Arriza
Current Assignee: Oregon Health Science University
1998-03-17: Application filed by Oregon Health Science University
2000-06-13: Application granted and published
2020-06-13: PATENT EXPIRED
So the 14 nucleotide sequence exists in humans as well as cows.
US6833447B1: Myxococcus xanthus (a bacterium) genome sequences and uses thereof
Inventor: Barry S. Goldman, Gregory J. Hinkle, Steven C. Slater, Roger C.
Wiegand,
2001-07-10: Application filed by Monsanto Technology LLC
2002-01-11: Assigned to MONSANTO TECHNOLOGY LLC
2004-12-21: Application granted and published
So the 14 nucleotide gene sequence exists in humans, in cows, and in bacteria. And it has been used in yeast.
Patent monopolies last for 20 years. So some of these monopolies granted on a novel use of naturally occurring DNA from humans, cows and bacteria, expired before Covid19 came along. But it was actually the British who started isolating and using DNA containing the 14 base pair insert first - woops!.
STEP 3: In order to make the sequence into a Furin cleavage site which gives the virus its infectivity, we must add the final Arginine codon CGT and get the 17 nucleotide sequence CTCCTCGGCGGGCACGT, which we call the double CGG coded furin cleavage site insert.
We now run a BLAST (Basic Local Alignment Search Tool https://blast.ncbi.nlm.nih.gov/Blast.cgi chose Blastn make sure align 2 or more sequences in unchecked and chose patent sequences) of every patent application for the 17 nucleotide Furin Cleavage Site sequence CTCCTCGGCGGGCACGT. Here are all the 100% match results (dated before the arrival of Covid19 in October 2019 according to Glenn Beck.
US9587003B2: Modified polynucleotides for the production of oncology-related proteins and peptides
- https://patents.google.com/patent/US9587003B2/en
Inventor: Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M.
Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P.
Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild
Current Assignee: ModernaTx Inc
2012-04-02 Priority to US201261618868P
2016-02-04 Application filed by ModernaTx Inc
2017-03-07 Application granted and published
US9301993B2: Modified polynucleotides encoding apoptosis inducing factor 1
- https://patents.google.com/patent/US9301993B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2013-12-16 Application filed by Moderna Therapeutics Inc
2016-04-05 Application granted and published
2020-01-10 First worldwide family litigation filed
US9255129B2: Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1
- https://patents.google.com/patent/US9255129B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2013-12-16 Application filed by Moderna Therapeutics Inc
2016-02-09 Application granted and published
US9216205B2: Modified polynucleotides encoding granulysin - https://patents.google.com/patent/US9216205B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2013-12-16 Application filed by Moderna Therapeutics Inc
2015-12-22 Application granted and published
US9149506B2: Modified polynucleotides encoding septin-4 - https://patents.google.com/patent/US9149506B2/en
Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Current Assignee: ModernaTx Inc
2013-12-16 Application filed by Moderna Therapeutics Inc
2015-10-06 Application granted and published
2020-01-10 First worldwide family litigation filed
Sequence 11651 from patent US 9149506
Sequence ID: HL240349.1
Range 1: 2762 to 2778
Plus/Minus (this means the match is for the reverse compliment of the sequence
which is CTCCTCGGCGGGCACGT because A bonds with T and C bonds with G.
Query 1
CTCCTCGGCGGGCACGT 17 CTCCTCGGCGGGCACGT Plus DNA
strand
|||||||||||||||||
|||||||||||||||||
Sbjct 2778 CTCCTCGGCGGGCACGT 2762
GAGGAGCCGCCCGTGCA Minus DNA strand
Query 1
TGCACGGGCGGCTCCTC 17 Reverse Plus DNA strand
|||||||||||||||||
Sbjct 2778 ACGTGCCCGCCGAGGAG 2762 Reverse Minus
DNA strand
2761 tacgtgcccg ccgaggaggc caccatcggc atcgtggacg gcatcttcac cagaatgggc
US9024113B2: Polynucleotides for expression of microbial starch
branching enzymes in plants for production of plants with improved yield
Inventor: Yongwei Cao, Gregory J. Hinkle, Steven C. Slater, Xianfeng Chen, Barry
S. Goldman, Current Assignee: Monsanto Technology LLC
2007-10-29: Application filed by Monsanto Technology LLC
2014-04-18: Assigned to MONSANTO TECHNOLOGY LLC
2015-05-05: Application granted and published
Monsanto used the sequence to genetically modify plants, not humans.
US8952217B2: Process for decreasing verbascose in a plant by expression
of a chloroplast-targeted fimD protein
Inventor: Piotr Puzio, Birgit Wendel, Michael Manfred Herold, Ralf Looser,
Astrid Blau, Gunnar Plesch, Beate Kamlage, Florian Schauwecker
Current Assignee: BASF Metabolome Solutions GmbH
2006-09-06: Application filed by Metanomics GmbH
2015-02-10: Application granted and published
BASF used the gene sequence for the Genetic Modification of plants.
US8372601B2: Compositions and methods for the synthesis of APPA-containing peptides (as antibiotics)
Inventor: William W. Metcalf, Wilfred A. van der Donk, Junkal Zhang, Benjamin T.
Circello,
Svetlana A. Borisova
Current Assignee: University of Illinois at Urbana Champaign
2011-01-21: Application filed by University of Illinois at Urbana Champaign
2011-02-28: Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN
SERVICES (DHHS), U.S. GOVERNMENT
2011-05-13: Assigned to UNIVERSITY OF ILLINOIS AT URBANA-CHAMPAIGN
2013-02-12: Application granted and published
"Exemplary vectors suitable for replication in mammalian cells may include viral
replicons, or sequences that ensure integration of an embodiment of the isolated nucleic acid of the present disclosure into the host genome. Suitable vectors may include, for example, those derived from simian virus SV40, retroviruses, bovine papilloma virus, vaccinia virus, and adenovirus"
"Expression of proteins encoded by an embodiment of the isolated nucleic acid of the present
disclosure then occurs in cells or animals which are infected with the live recombinant
vaccinia virus."
This patent is about manufacturing proteins containing the amino acid sequence APPA. Covid19 does contain that sequence but not in the spike protein, which has the furin cleavage site. The patent claims DNA similar to Patent gene sequences 2,3,4 and 5-13. Whereas the Furin Cleavage site occurs in Patent gene sequence 14. So it is incidental to the patent.
US7635798B2: Nucleic acid compositions conferring altered metabolic
characteristics
Description: This invention encompasses the identification and isolation genes
and gene fragments that confer altered metabolic characteristics in Nicotiana
benthamiana plants, when expressed using GENEWARE™ viral vectors.
Inventor: Thaddeus Weglarz, Daniel Gachotte, Beth Blakeslee, Ignacio Larrinua,
David A. McCrery, Randy J. Pell, J. Vincent B. Oriedo, Barbara A. Miller, Avutu
S. Reddy, Vipula Shukla, Rodney Crosley
2002-08-30: Application filed by Dow AgroSciences LLC
2004-10-01: Assigned to DOW CHEMICAL COMPANY, THE
2005-01-14: Assigned to DOW AGROSCIENCES LLC
2009-12-22: Application granted and published
Dow Agrisciences was using viruses to Genetically modify Tobacco plants.
US7314974B2: Expression of microbial proteins in plants for production
of plants with improved properties
Inventor: Yongwei Cao, Gregory J. Hinkle, Steven C. Slater, Xianfeng Chen, Barry
S. Goldman
2003-02-20: Application filed by Monsanto Technology LLC
2003-08-25: Assigned to MONSANTO TECHNOLOGY LLC
2008-01-01: Application granted and published
Monsanto used the gene sequence in their genetic modification of plants not
humans or viruses.
US6869788B2: DNA encoding novel D-aminoacylase and process for producing
D-amino acid by using the same
Inventor: Masami Osabe, Katsuyuki Takahashi, Toshifumi Yamaki, Teruo Arii,
Toshihiro Oikawa
2002-02-01: Application filed by Mitsui Chemicals Inc
2002-09-30: Assigned to MITSUI CHEMICALS, INC.
2005-03-22: Application granted and published
Not to do with viruses.
STEP 4: Run a BLAST
(Basic Local Alignment Search Tool https://blast.ncbi.nlm.nih.gov/Blast.cgi
chose Blastn make sure 'align 2 or more sequences' is unchecked and chose patent
sequences) of every patent application for the 15 nucleotide Furin Cleavage Site
sequence CCTCGGCGGGCACGT, which codes for PRRAR, Here are all the 100% new match
results.
US6833447B1: Myxococcus xanthus (a bacterium) genome sequences and uses thereof
Inventor: Barry S. Goldman, Gregory J. Hinkle, Steven C. Slater, Roger C. Wiegand,
2001-07-10: Application filed by Monsanto Technology LLC
2002-01-11: Assigned to MONSANTO TECHNOLOGY LLC
2004-12-21: Application granted and published
The usual Monsanto team. So the CGG coded Furin Cleavage Site does exist in bacteria in nature, but not in viruses in nature.
US6912470B2: Genes and proteins involved in the biosynthesis of enediyne ring structures
Inventor: Chris M. Farnet, Alfredo Staffa, Emmanuel Zazopoulos,
Current Assignee: Thallion Pharmaceuticals Inc
2002-05-21: Application filed by Ecopia Biosciences Inc
2005-06-28: Application granted and published
Enediyne rings are cancer torpedoes. Ecopia were trying to improve the functionality and production of these torpedoes, which are not proteins. .
US7314974B2: Expression of microbial proteins in plants for production of plants with improved properties
(Transgenic Plants)
Inventor: Yongwei Cao, Gregory J. Hinkle, Steven C. Slater, Xianfeng Chen, Barry S. Goldman
2003-02-20: Application filed by Monsanto Technology LLC
2003-08-25: Assigned to MONSANTO TECHNOLOGY LLC
2008-01-01: Application granted and published
US7750207B2: Transgenic plants:
Inventor: Kunsheng Wu, Santanu Dasgupta, Targolli L Jayaprakash, Shoba Cherian
Current Assignee: Monsanto Technology LLC
2006-09-01: Application filed by Monsanto Technology LLC
2010-07-06: Application granted and published
US7834146B2: Recombinant Polypetides Associated with Plants
Description: The Polypeptides may be promoted in the plants through Plant
viruses such as the Cauliflower Mosaic Virus.
Inventor: David K. Kovalic, Yihua Zhou, Yongwei Cao, Scott E. Andersen, Michael D. Edgerton, Jingdong Liu
Current Assignee: Monsanto Technology LLC
2004-01-29: Application filed by Monsanto Technology LLC
2010-11-16: Application granted and published
So Ecopia was the first to file a human therapeutic use of the double CCG
Furin Cleavage site insert in the form of better Enediyne ring cancer torpedoes
on 2002May21
Dow Agrisciences was the first to file a patent to use it in a plant virus in
2002August30
The University of Illinois was the first to file a patent for the use the double
CGG Furin Cleavage Site insert in a human virus on 2011January21. But they were
trying to make APPA containing proteins as antibiotics. The Furin Cleavage Site
was incidental to their patent.
Moderna is the only other outfit to file a human use of the insert before 2019.
They filed 5 patents using the insert from 2013December16 to 2016February4. They
were the last 5 patents filed using it before Covid19 broke out in October 2019.
STEP 5: Run a BLAST (Basic Local Alignment Search Tool https://blast.ncbi.nlm.nih.gov/Blast.cgi chose Blastn make sure 'align 2 or more sequences' is unchecked and chose all genomes and choose complete genomes) search of microbes for the 15 nucleotide Furin Cleavage Site sequence CCTCGGCGGGCACGT, which codes for PRRAR. It finds more than a thousand bacteria known to have this gene sequence! Myxococcus Xanthus has it 209 times!
So over a thousand bacteria have multiple copies of it. Humans have it. Cows have it. Plants have it. But no viruses have it at all except Covid19.
If nature was going to give it to viruses it would have done it by now, like it did with humans, like it did with cows, like it did with bacteria and like it did with plants..
The final codon completed inserted gene sequence CTCCTCGGCGGGCA does not exist in natural viruses and neither does the CGG coded Furin Cleavage site CCTCGGCGGGCACGT which codes for PRRAR. But they do exist naturally in bacteria and in humans and in cows and in plants. Viruses can invade bacteria and insert their genes into the them. But bacteria cannot insert their genes into viruses. So the only way for bacterial DNA to end up in a virus is by human intervention. So Covid19 must have been man made.
The Double CGG Codon used in the Moderna Specific Furin Cleavage site does not occur in any other Furin cleavage site in any other virus in nature. Furin cleavage sites do occur in other viruses but NOT at all in other betacoronaviruses like Covid-19 and NOT at all with the double CGG codon..
Arginine (R), can be encoded by any of the 6 triplets: AGG, AGA, CGA, CGC, CGG, CGT. In Covid-19, the furin site (PRRA), has 12 nucleotides (3 x 4). In Covid-19, the RR doublet of the furin site is encoded by CGG-CGG.
Two Biochemists Prof Antonio R. Romeu and Assistant Prof Enric Ollé analysed the RR doublet from a large sample of furin cleavage sites of several kinds of viruses. They found that there were no RR doublets encoded by the CGG-CGG codons in any virus in nature. They observed that the AGA triplet was the majority codon involved in these viral RR doublets. In all genetic recombination (where a part of one genome merges with another genome), the donor code is passed to the acceptor. But there is simply NO KNOWN VIRUS with a Moderna Specific Furin Cleavage Site (having the CGG-CGG codon pair) that exists to donate a Moderna Specific furin cleavage site to Covid19. So the only way that sequence could get into Covid-19 is from man. Mankind was the donor. Nature was not. QED. Case Closed.
But it gets worse.
The Spanish Profs decided to analyse the arginine codon usage in every single
protein in Covid-19. The found the following...
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%).
So the AGA codon triplet was the majority, and interestingly, CGG was the minority codon for Arginine in the virus.
But it gets worse still.
In the specific case of S protein, of the 42 Arginines (R) it has, 20 are encoded by AGA, and only 2 by CGG. These 2 of course, are the two in the Moderna Specific Furin Cleavage Site.
So the only Arginine in the spike protein that is encoded a la Moderna are in the Furin Cleavage site. The other 40 instances do not use CGG at all.
They then go on to comment that each individual species in nature has its own codon preferences. Obviously viruses like AGA, and do not like CGG at all, in nature.
But guess which species does use CGG for Arginine more than the other 5 competing codons - yes its jolly old homo sapiens. Our coding preferences for Arginine are
AGG (20%)
AGA (20%)
CGA (11%)
CGC (19%)
CGG (21%)
CGT (9%).
So the CGG codon in the furin cleavage site WILL have come about through Chimeric (human animal combination) gain of function research.
"New documents show that just 18 months before the first Covid-19 cases appeared, researchers had submitted plans to release skin-penetrating nanoparticles and aerosols containing “novel chimeric spike proteins” of bat coronaviruses into cave bats in
Yunnan, China. They also planned to create chimeric viruses, genetically enhanced to infect humans more easily, and requested
$14 million from the Defense Advanced Research Projects Agency (Darpa) to fund the work.
Papers, confirmed as genuine by a former member of the Trump administration, show they were hoping to introduce “human-specific cleavage sites” to bat coronaviruses which would make it easier for the virus to enter human cells.
When Covid-19 was first genetically sequenced, scientists were puzzled about how the virus had evolved such a human-specific adaptation at the cleavage site on the spike protein, which is the reason it is so infectious."
-
the Telegraph
I can see all of the great journalists at the Daily Mail and the Telegraph
(not to mention scientists around the world) doing all of this research into
Covid19 and reaching the inevitable logical conclusion that there was either an
accidental or a deliberate lab leak and then having to word their conclusions in
such a way as to label that strong probability as a weak possibility. But
here above we have proved it as a fact (since the Moderna Specific Furin
Cleavage Sequence CGG codon does not occur in any furin cleavage site in any
natural virus and therefore it cannot have been the result of natural genetic
recombination. So it has to be the result of man made genetic insertion).
In theory a further party involved with the NIAID or the NIH could have used the furin cleavage site cited in Moderna's patents and made Covid19 themselves. The Furin cleavage site itself is not patentable having been known since at least 2004
US7223390B2: Insertion of furin protease cleavage sites in membrane proteins and uses thereof
2004-05-07 Application filed by Research Development Foundation
2004-11-11 Publication of US20040224391A1
2007-05-29 Application granted
Peter Daszak, The Eco Health Alliance DARPA, the NIH and the US Intelligence Coomunity
The jounrey begins with Moderna. But the rabbit hole goes far deeper. It goes as deep as a rabbit hole can go. Because the only way the all the governments in the world can pull the same deception on nearly all the nations of the world (wth the notable exception of India) at the same time, with no resistance from the mainstream media in any of these countries, is if the entire worldwide intel community is behind it. Big Pharma has a lot of influence. But not that level of total worldwide coordination.
The US Intelligence services showed their involvement when Presidential Impersonator (for Obama46) Biden asked them to produce an intelligence assessment for the origin of Covid-19. Their 3 month long investigation yielded nothing. And given the relationships between the NIAID, the NIH, the WIV, the EcoHealth Alliance, the University of North Carolina and Fort Detrick and Moderna, I cannot see any way they did not know. Furthermore the entire unholy cabal of bad actors started developing the Moderna Vaccine before the pandemic struck - https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine-began-development-weeks-ahead-of-pandemic/
But the slam dunk proof is that Moderna's own website at https://www.modernatx.com/patents
shows the following 7 patent filings for their gene therapy mRNA-1273 (amino acid chain) vaccine...
US 10,703,789 filed January 12 2019
US 10,702,600 filed February 28 2020
US 10,577,403 filed June 12 2019
US 10,442,756 filed December 18 2017
US 10,266,485 filed June 11 2018
US 10,064,959 filed April 21 2017
US 9,868,692 filed July 27, 2017
The 2nd patent, filed on February 28 2020 was a continuation of an earlier patent application number 16/368,270 which was filed on March 28, 2019
So they had all 7 patents applied for by June12, 2019, which is quite impressive given that the WHO was only informed of a pneumonia type outbreak in Wuhan on December 31, 2019.
So all the patents needed to protect Moderna's particular vaccine monopoly were applied for more than 6 months before the outbreak of the disease that the vaccine is supposed to be curing.
This proves that the Moderna were involved in its manufacture and that the purpose of the 'lab leak' was to make a market for pre-existing vaccines in the case of
Moderna. The leak occurred to force people to have to take the vaccine.
Nature has had certainly 100,000 years to make human viruses and it never once put a double CGG furin cleavage site into any virus. Yet within 6 years of Moderna referring to it in their patents, we find it in Covid-19 in circumstances where Moderna is working on a vaccine for that virus. So just there the probability is not 100,000 to 6 or 16,666 to 1 that Moderna is responsible rather than nature. No it is 100% because nature has not done it in a virus. It never has and there is no evidence that it ever will.
It is man that mixes up human and viral Arginine codons not nature.
US 10,703,789 Here is what the Patent claims: Claim1. A pharmaceutical composition comprising:
a plurality of lipid nanoparticles comprising a cationic lipid, a neutral lipid, a cholesterol, and a PEG
(polyethylene glycol) lipid, wherein the plurality of lipid nanoparticles has a mean particle size of between 80 nm and 160 nm; and
wherein the lipid nanoparticles comprise an mRNA encoding a polypeptide, wherein the mRNA comprises:
(i) at least one 5′-cap structure;
(ii) a 5′-UTR (UnTranslated Region);
(iii) an open reading frame encoding the polypeptide and consisting of nucleotides including
N1-methyl-pseudouridine (fake Uracil), cytosine, adenine, and guanine;
(iv) a 3′-UTR; and
(v) a poly-A region of least 100 nucleotides in length.
Claim1 is basically the finished vaccine. So in October 2019, just 4 months after 2019June12 when they got the N1 Methyl Pseudouridine (fake Uracil) patent filed, 10 hospitals in Wuhan had Coronavrius cases according to Glenn Beck's documentary.
"We do know just about 12 months later in Wuhan – where Peter Daszak, Dr. Shi, the bat lady, and Dr Baric were all doing research on coronaviruses – about a year later, there’s an outbreak, and the outbreak actually begins according to documents that we have that have been smuggled out of China that there were 10 hospitals involved by October with patients that were now, we now know, are corona-like virus symptoms. They didn’t know what was going on. Now, that was in October". - Glenn Beck - https://thelibertydaily.com/glenn-beck-drops-bombshells-on-tucker-nih-claims-joint-ownership-of-moderna-vaxx-started-working-on-it-long-before-pandemic/
So the writer can confirm, and the reader can confirm using the links above, that Moderna did apply for a Patent on the reverse compliment of the double CGG coded 15 nucleotide Furin Cleavage Site in Covid-19 and actually on the 19 nucleotide sequence containing it as described above. Furthermore they did not merely apply for a patent on 2016 February 4 with US9587003B2: as reported in the Daily Mail. They actually applied on 2013 December 16 for 4 patents with US9149506B2, US9216205B2, US9255129B2, US9301993B2:as well.
So Moderna had developed the 19 nucleotide gene sequence containing the Furin Cleavage Site which gives Covid19 its infectivity to humans by patented gain of function research as early as 2013, 6 years before the Wuhan outbreak took place. Not 3 as reported in the Mail and virally elsewhere. But the bat coronavirus RaTG13 from which Covid19 was derived was also discovered in 2013. Well, what a coincidence!
The reason that the writer is so confident that Moderna or their agents made and leaked Covid-19 and the reason he called it as such at the start of the pandemic to almost as much ridicule as Prof Montagnier received (God bless him) is that the scriptures say in Matthew27, Mark15 and John19 that.
29 And they (the soldiers of the governor of verse 27)
platted a crown of thorns and put it upon his head, and a reed in his right
hand; and they kneeled down before him, and mocked him, saying, Hail, King of
the Jews!
30 And they spat upon him, and took the reed and smote him
on the head. (Matthew 27 ASV)
May I therefore beg your indulgence whilst I interpret these words:
The US department of defence funded the gene splicing of the Coronavirus of Spike Proteins (Covid-19) through NIH and NIAID and DARPA which first infected Jesus, through his fiance, the New Covenant Saints, just after he became the secular King, Caesar to those saints, the antitypical Jews, those covenanted to be angelic sons of Jacob, the born agains angelically. We calculated that the malediction which prevented Jesus becoming Caesar to the saints ended in 2019Tishri15 (October17/18). Glenn Beck did a documentary showing that 10 hospitals in Wuhan took cases with Covid19 symptoms in October 2019. Yes Folks. Covid-19 is a proof that Jesus had his crown upon his head in 2020. In fact we understand that the last 1st New Covenant saints was married to him on 2020Tammuz19 (2020Jul11/12). So yes, all the true first New covenant cup drinkers have left the building and are now resident upon the head of Jesus, playing their part in the crowd of 12 stars of Revelation12.
But then the soldiers spat upon him. For that is how Covid19 is transferred, through small aerosol droplets exhaled out of the mouth. The soldiers deliberately spat upon him. It was not a SALIVA LEAK! They smote Jesus on the head because the saints are the head of the church and they caught Covid19 not by random chance infection but by a deliberate smiting with a read, a biological weapon, a deliberate weaponised attack. For more on this see here.
So what Prof Montagnier saw with his virology expertise, I saw with my theological expertise. Showing that whilst fact checkers and science are mutually exclusive, science and theology actually agree, when properly understood (and that is one big caveat). Prof M taught us that the vaccines cause the variants. Indeed basic virology forbids mass vaccination during a pandemic for that very reason. He said the the curve of deaths follows the curve of vaccinations. Mind you, paradoxically, if the vaccines caused Omicron, then they saved us from themselves!
The Covid19 makers, the genetic vaccine makers. their funders and their promoters, which include almost every government and public sector and health service in the world, are therefore guilty of Genocide and crimes against humanity. They have pushed genetic rape and sickness and death onto half of the population of the world in order to enrich the pockets of Pharmaceutical Companies. Governments and Public sectors around the world have abandoned their health service regulation to billionaires and heartless corporations
In the UK, all of the income tax we pay goes to the health service and all of its protocols are determined by its regulators and all of its regulators are controlled and funded by Big Pharma who seek to damage then manage our health for their profit.
So every penny we spend in income tax brings us one step closer to sickness, to death and to drug dependency.
Covid-19 was not made in 2019. It was made from the 19 nucleotide Moderna
specific chimeric (CGG for AGA) furin cleavage site which does not occur
anywhere in nature.
And every Covid death and every Covid vaccine death is parked squarely on their
doorstep waiting for justice. But Moderna is only the shop front in this multi
layered deception. Behind them in the Ralph Baric and the NIH and the Univeristy
of North Carolina at Chapel Hill, the dehind them is Fort Detrick, and behind
them in Peter Daszak and his DARPA proposal and behind that rejection is the US
intel agency classification of the DEFUSE proposal from Daszak to put the
Moderna specific Double CGG codon Furin Cleavage site into the DaTg13 Bat
Coronavirus.
But we shall not execute that justice fast enough and therefore the final plague upon mankind of Revelation 6:8, delivered by the 4th horseman of the apocalypse, which plague Bill Gates himself has prophesied, will arrive later in 2023 year (after War and after Famine, the 2nd and 3rd horsemen).
A certain professor from a UK Teaching Hospital wrote to me as follows
"You aught to read this from the Wikipedia article
Furin cleavage site
Some claims of bioengineering focus on the presence of two sequential cytosine-guanine-guanine (CGG) codons in the virus' RNA, more precisely in the crucial furin cleavage site.[9][74] The CGG codon is one of several codons that translates into an arginine amino acid, and it is the least common arginine codon in human pathogenic betacoronaviruses.[105] Partially, this lack of CGG codons in human pathogenic coronaviruses is due to natural selection: B-cells in the human body recognize areas on virus genomes where C and G are next to each other (so-called CpG islands).[15][106] The CGG codon makes up 5% of the arginine codons in the SARS-CoV-1 genome, and it makes up 3% of the arginine codons in the SARS-CoV-2 genome.[9] Proponents of an engineered virus, including journalist Nicholas Wade, claim that two such uncommon codons in a row are evidence for a laboratory experiment; because of the low chance of a CGG codon pair occurring in nature, and in contrast, the common usage of CGG codons for arginine in genetic engineering work.[9][74] This has been disputed by scientists, who note that the CGG codon is also present (and even more frequent) in other coronaviruses, including MERS-CoV,[107] and that a codon being rare does not mean it cannot be present. In addition, the presence of the furin cleavage site, which is responsible for a significant increase in transmissibility, largely outweighs the disadvantageous immune responses from B-cells triggered by the genetic sequences which code for it.[106][15]
You are unlikely to gain support from people who are actually involved in genetic engineering and evolutionary studies like myself.
I will delete this thread and block your email after sending.
xxx - not easily taken in - xxxxx "
So I looked up the paper by the plurality of "scientists" as opposed to the singular "journalist" Nicholas Wade - reference 107. And wrote the following response and checked that his email server did accept my email...
Dear Prof XXX,
Thanks for your email. If you can prove my reasoning wrong I would be happy to write a correction in my next article.
I read the one reference cited in Wikipedia for MERS-CoV having the CGG Codon and that paper states explicitly and emphatically...
"All human coronaviruses analyzed in this study did not use two synonymous codons (CGC, CGG) for arginine as well as CCG for proline and UGA for stop codon at all. " -
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7487440/
My argument is very simple.
No virus in nature uses the CGG codon for Arginine in a furin cleavage site. I did check that in the blast database. I did the search. Nothing came up.
Please therefore show me a naturally occurring virus (preferably one that appeared before Moderna appeared) with a furin cleavage site containing two CGG codons and you will defeat my argument.
I am afraid you were taken in XXX - not by me, but by Wikipedia !
Regards....
I got no response from the Professor. But strangely Wikipedia changed the reference number from 107 to 116 in the article above. Yet it still links to the same paper? So Wikipedia is falsely inferring that "scientists", as opposed to one lone journalist, dispute that there is a low chance of double CGG occurring in nature, by noting that the CGG codon occurs in MERS citing a paper which explicitly declares that none of the human coronaviruses analysed within it used a double CGG codon, No true scientist can dispute the low chance of a sequence occurring in viruses by analysing viruses in which said sequence does not occur. Wikipedia is providing disinformation which just happens to protect the interests of pharmaceutical companies
But all of this is - dare I say it - academic. Because there are absolutely no viruses which have a CGG doublet in a Furin Cleavage site (PRRAR) except Covid-19 and except plant viruses which Dow Agroscience. Monsanto, or the like, have modified. And whether you are a journalist or a cell biologist or both (like myself) or neither, this article gives you the tools to check that FACT for yourself.
https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/ Search for CCTCGGCGGGCACGT which codes for PRRAR,
The writer has just realised that in early 2018. when DARPA outwardly rejected Peter Daszak's application for $14,209,245 for his project DEFUSE to engineer a human lung airway lining cell specific furin cleavage site at the S1/S2 junction (the junction of the 2 parts of the spike protein) where no other SARS related coronavirus has ever had such a site, the US deep state (US intelligence) actually accepted the project and classified it, having instructed DARPA to reject it as a cover story.
We know that to be true because in late 2019 SARS- CoV-2 and Covid19 appeared with a humanized furin cleavage site in precisely the position that Daszak had proposed and furthermore it took the humanized codon form of CCT CGG CGG GCA CGT coding for the 5 amino acids PRRAR, in a humanised furin cleavage site. Which form is unknown in any virus at all. But it is known in cows and humans and many bacteria. Since cows, bacteria and humans cannot infect viruses, nature cannot have put it there. The only way for that coding to get into a virus is by a human being gene splicing it into the viral genome. Prof Luc Montagnier first realised this in 2020 by considering the HIV components in the SARS-CoV-2 spike protein.
So we know that a human called Peter Daszak proposed the insertion in early 2018. We know that only a human could have inserted it. And we know that said insertion occurred in late 2019. And we know that said insertion was the only difference longer than one Codon (3 bases) between SARS-CoV-2 (causing Covid-19) and the bat coronavirus RaTG13. And we know that the insertion occurred at the place that Daszak had proposed to insert it. And we know that the insertion was a humanised furin cleavage site as Daszak had proposed. In other words SARS-CoV-2 was the fulfilment of the 75 page project DEFUSE proposal.
If DARPA had accepted the proposal, we would all know that Peter Daszak made Covid-19 (using the term metonymically to stand for the virus that causes the disease).
So the question now becomes. Would DARPA, whose job it is to fund Advanced Research Projects to give the US a strategic advantage over its competitors in all areas of human conflict, have said to Peter Daszak: Sorry old chap. We are not interested in your bioweapon because it is just too dangerous for us! But we do know you have a lot of dealings with Wuhan. So why not try the Chinese with this really dangerous bioweapon you are proposing to make? Maybe you will have better luck with them? I cannot imagine anything more implausible.
Their reasons for rejection
were essentially...
Gain of Function concern
Dual Use Research of Concern
Vaccine epitope coverage (immunity would be too narrow being restricted only to
the spike protein - yes indeed! - they were worried that the vaccines would not
work since their immunity would be too specific!)
Regulatory requirements
ELSI (ethical, legal, and social issues)
Data Usage
In other words: They rejected his application because he presented it in the wrong typeface (in biological terms).
It is clear from the events immediately following the official rejection that the project was funded extremely quickly in a clandestine way. Because for an unfunded project it was singularly successful, in a very short period of time!
So it was classified. That is why DARPA outwardly rejected it. So the US deep state essentially employed Peter Daszak and the EcoHealth Alliance to make Covid-19 for US covert operations.
It is also apparent that it was funded AND produced in a clandestine way because Peter Daszak arranged for a letter to be written to the Lancet by 27 academics on 2020February19 calling all scientists who rejected a natural origin for Covid-19 conspiracy theorists. Whereas the true conspiracy theory was that there was any way it could have come from nature...
"The rapid, open, and transparent sharing of data on this outbreak is now being threatened by rumours and misinformation around its origins. We stand together to strongly condemn conspiracy theories suggesting that COVID-19 does not have a natural origin. Scientists from multiple countries have published and analysed genomes of the causative agent, severe acute respiratory syndrome coronavirus 2
(SARS-CoV-2), and they overwhelmingly conclude that this coronavirus originated in wildlife, as have so many other emerging pathogens.
This is further supported by a letter from the presidents of the US National Academies of Science, Engineering, and
Medicine and by the scientific communities they represent. Conspiracy theories do nothing but create fear, rumours, and prejudice that jeopardise our global collaboration in the fight against this virus. We support the call from the Director-General of WHO to promote scientific evidence and unity over misinformation and
conjecture. We want you, the science and health professionals of China, to know that we stand with you in your fight against this virus.
We invite others to join us in supporting the scientists, public health professionals, and medical professionals of Wuhan and across China. Stand with our colleagues on the frontline!
We speak in one voice. To add your support for this statement, sign our letter online. LM is editor of ProMED-mail. We declare no competing interests."
- https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30418-9/fulltext
That letter is not the wording of a scientist. It is the wording of an intelligence operative, a lying manipulator, a deceiver, a slanderer.
The Lancet panel investigating the lab leak versus natural origin theories was disbanded by its chairman Jeffrey Sachs on Saturday 2021September25, over its ties to Peter Daszak. https://www.dailymail.co.uk/news/article-10028443/Lancets-COVID-origins-panel-disbands-ties-Peter-Daszaks-EcoHealth-Alliance.html
What interest would Peter Daszak have in dishonestly trying to discredit the man made Covid-19 origin theory in Britain's premier medical journal unless he or his EcoHealth Alliance was involved in the making of it?
So we have a guy who submits a proposal to DARPA in 2018 to make the virus behind Covid-19 in precisely the way that it appeared in 2019, and in a way that nature could not possibly have made it (with the double CGG codon in the furin cleavage site which exists in no other virus and which exits in no other SARS type virus at the S1/S2 junction) and then that same man manufactures a fraudulent letter to the Lancet, Britain's premier medical journal, trashing the man made origin theory and declaring he has no competing interests!
He obviously did make it. Which means that DARPA's rejection was cosmetic and designed to throw people off the scent. Which means that the US deep state did fund it. Which means that Covid19 it is a US bioweapon as are its vaccines.
I mean would the people who funded more than a dozen SECRETIVE biolabs in Ukraine really reject a bioweapon from Peter Daszak? Or would they overtly reject it whilst secretly accepting it?
Richard Ebright, a molecular biologist at Rutgers University who has espoused the possibility that SARS-CoV-2 may have originated in a lab, agreed. “The relevance of this is that SARS Cov-2, the pandemic virus, is the only virus in its entire genus of SARS-related coronaviruses that contains a fully functional cleavage site at the S1, S2 junction,” said Ebright, referring to the place where two subunits of the spike protein meet. “And here is a proposal from the beginning of 2018, proposing explicitly to engineer that sequence at that position in chimeric lab-generated coronaviruses.” - https://theintercept.com/2021/09/23/coronavirus-research-grant-darpa/
But the treachery of the US deep state did not stop at the virus. This is an intelligence exercise. Its purpose is a little more far reaching than giving mankind a slightly more lethal version of the flu. This is where Moderna, the NIH under Francis Collins (now resigned) and the NIAID under Fauci (presently resigning) come in. For the purpose of the virus was to enable the vaccine mandates (after the deep state had gained control of the regulators and enough of the politicians). This is another sign of an intelligence operation. For Colby famously said at the time of Watergate...
"The CIA owns everyone of any significance in the major media" (William Colby 1920 - 1996 - director of the CIA). He said this during the extraordinarily successful Watergate cover up involving a full and total failure of the US security services, from 1973-1976. We know that the words of Colby were true (notwithstanding the plethora of intelligence agency inspired websites dishonestly proclaiming the opposite) because that cover up worked other than in the cases of Woodward and Bernstein, who were not at the time considered to be persons of any significance in the major media.
And just as they owned every person of significance in the main stream media back then. So do they own them all today I fear. Except that they have added to that ownership every person of any significance in Pharmaceutical regulation, because that is how they operated back then and that is how they operate today.
The most pathogenic part of the virus was the spike protein, indeed that is where the humanised furin cleavage site was inserted. So they made a vaccine which produces far more spikes in your body than a full blown Covid-19 infection. And they made the vaccinated spikes last for months and months (rather than the 7-14 days of a Covid-19 infection) either by permanently adding to your cell DNA with Astra Zeneca or J&J adenoviruses or by infecting your cells with with 'stabilised' i.e. perpetual RNA, which they innocently called modified RNA, but which is in fact hacking RNA which hides the fact that it is genetic material from your cells (using N1 Methyl Pseudouridine, a fake form of Uracil, one of the 4 bases of RNA). This hacking RNA therefore becomes an email to your cell ribosomes which cannot be deleted and just goes on instructing them to make more and more and more and more spikes, until either the cell dies, or is killed by your T cells. That is if the spikes do not themselves infect your T cells first before they can do their job.
So any disease that the medical media or the main stream media says is caused by Covid-19 spikes is caused to a much larger extent by the vaccines which, are turbo Covid-19 as regards spike production.
These spikes do not only affect your heart, your central nervous system, your body organs, your immune system and your reproductive system. They affect your state of mind.
"Among 236,379 patients diagnosed with COVID-19, the estimated incidence of a neurological or psychiatric diagnosis in the following 6 months was 33·62%" - https://www.thelancet.com/journals/lanpsy/article/PIIS2215-0366(21)00084-5/fulltext
Of course, the paper did NOT specify how many of these patients had been vaccinated (had it done so it would never have been published or funded). But we know from the Exposé that 9 out of 10 hospitalised patients are fully vaccinated (whatever that means these days). So these spike proteins (be it from the virus or more so from the vaccine) are causing significant damage to the brain.
Dr. Stephanie Seneff is a senior research scientist at MIT, where she has had a continuous affiliation for more than five decades. She has four advanced degrees from MIT, including a B.S. in Biophysics, an M.S., E.E., and a Ph.D. in Electrical Engineering and Computer Science. She has been predicting neurodegenerative disease from spike proteins since 2021.
I have anecdotally experienced this with vaccinated people whom I have known for a long time becoming more destructive than I have ever seen them before after a few drinks. I am beginning to think that alcohol and Vaccines do not mix.
I would be interested to know if any other readers have seen this? When I have spoken to friends they have confirmed similar behaviour. Drunken vaccinees become unreasonable, anempathetic, destructive, aggressive, dishonest, and absurdly negative. I mean more so than a bad alcoholic. I have seen this happening to people I love and I really do not like it.
US Government Funding for Peter Daszak and ECO Health Alliance
Government Department | Grant Value | Period |
DoD Department of Defense | $38,949,941.00 | 2013-2020 |
HHS Health & Human Services (includes NIH and CDC) | $13,023,168.00 | 2007-2020 |
National Science Foundation | $2,590,418.00 | 2006-2020 |
USAID US Agency for International Development | $2,499,147.00 | 2013-2016 |
DHS Department of Homeland Security | $2,272,813 | 2016-2019 |
DoC Department of Commerce | $1,241,933.00 | 2006-2010 |
USDA US Department of Agriculture | $646,701.00 | 2007-2009 |
DoI Department of the Interior | $267,062.00 | 2004-2014 |
Total | $61,491,183 | 2004-2020 |
US government Funding of the Wuhan Institute of Virology
The Wuhan lab got a $3.7 million grant from the US government approved by Obama running over 4 years from 2015 to 2019. - https://www.snopes.com/fact-check/obama-admin-wuhan-lab-grant/
Fauci also gave them $3.7 million from the NIAID (National Institute of Allergy and Infectious Diseases) - In 2019, with the backing of NIAID, the National Institutes of Health committed $3.7 million over six years for research that included some gain-of-function work. The program followed another $3.7 million, 5-year project for collecting and studying bat coronaviruses, which ended in 2019, bringing the total to $7.4 million. - https://www.newsweek.com/dr-fauci-backed-controversial-wuhan-lab-millions-us-dollars-risky-coronavirus-research-1500741
"The controversy was such that it led to a Congressional moratorium on chimeric research in the USA. At which point, Dr. Antonio Fauci diverted 3.7 Million U.S. Dollars of U.S. Taxpayer monies to the Wuhan Institute of Virology to continue the research.
Rudy Giuliani, legal counsel to U. S. President Donald Trump, and former Mayor of New York city, recently demanded an explanation from Dr. Fauci for this transfer, which violated U.S. Laws against funding the research.
In addition to the research done at Chapel Hill, North Carolina, the specific kind of research into Coronaviruses as possible biological warfare agents, was being done at Fort
Detrick, Maryland, USA, by the U. S. Army, which has a Level 3 and 4 Biowarfare Lab at the military base. This lab was cited by the U.S. Center for Disease Control and Prevention
(CDC) in July, 2019 for failure to maintain proper containment standards"
- https://www.from
rome.info/tag/fort-detrick/ (remove the space from the link)
NIAID and NIGMS Funding of Ralph S. Baric at the University of North Carolina Chapel Hill
2001 May1: https://grantome.com/grant/NIH/R01-GM063228-03
$1,007,735 over 4 years from 2001 to 2004
NIGMS (National Institute of General Medical Sicences)
Reverse Genetics with A Coronavirus Infectious Construct
Baric, Ralph S.
University of North Carolina Chapel Hill
2004 February15: https://grantome.com/grant/NIH/R01-AI059136-01
$1.402,316 million over 5 years from 2004 to 2008.
Reverse Genetics
Baric, Ralph S.
University of North Carolina Chapel Hill
Aim 1, we will develop a full length SARS cDNA clone and compare the
phenotype of rescued molecular cloned viruses with wildtype using biochemical
assays and macaque challenge experiments.
Aim 2, we will develop high titer SARS single hit replicons for use as
expression vectors and vaccines.
Aim 3, we will select for SARS host range mutants that replicate in murine
(mouse and rat) cells, identify the mechanism of SARS cross species transmission
using reverse genetic approaches and evaluate the pathogenicity of these viruses
in rodents and non human primates. The goal of this application is to establish
genetic control over the SARS genome and provide uniform reagents that will be
used by other groups throughout the country.
2004 May15: https://grantome.com/grant/NIH/R01-AI061819-01
$367,042 for 2004
Remodeling SARS Coronavirus Genome Regulatory Networks
Baric, Ralph S.
University of North Carolina Chapel Hill
2005 May1: https://grantome.com/grant/NIH/P01-AI059443-01A1
$1,676,513 for 2005
Developing Vaccine Candidates for the SARS Coronavirus
Baric, Ralph S.
University of North Carolina Chapel Hill
Total NIAID funding for Ralph Baric at University of North Carolina was $46,958,414. (https://grantome.com all grants to Baric, Ralph)
Year | Grant |
2000 | 201,232 |
2001 | 455,041 |
2002 | 253,321 |
2003 | 902,719 |
2004 | 1,628,345 |
2005 | 3,277,688 |
2006 | 3,262,315 |
2007 | 3,315,802 |
2008 | 3,539,843 |
2009 | 4,273,858 |
2010 | 1,877,793 |
2011 | 1,703,273 |
2012 | 6,871,244 |
2013 | 8,985,633 |
2014 | 1,404,641 |
2015 | 222,637 |
2016 | 1,368,161 |
2017 | 3,414,868 |
Total | 46,958,414 |
Dr David Martin - https://www.davidmartin.world/wp-content/uploads/2021/01/The_Fauci_COVID-19_Dossier.pdf
(not entirely accurate)
https://21a86421-c3e0-461b-83c2-cfe4628dfadc.filesusr.com/ugd/659775_6f632cc8d75d4d8c8b90cc749262f4b4.pdf
Richard Flemming (comprehensive).
www.lordswitnesses.net/downloads/Flemming.pdf
Richard Flemming (comprehensive).
https://www.webmd.com/lung/news/20030411/sars-timeline-of-outbreak
(detailed)
We are being asked to believe that
The DoD (Department of Defense)
The HHS Health & Human Services (includes NIH and CDC)
The NIAID
The National Science Foundation
The USAID (US Agency for International Development)
The DHS (Department of Homeland Security)
The DoC (Department of Commerce)
The USDA (US Department of Agriculture)
The DoI (Department of the Interior)
All funded Peter Daszak and the EcoHealth Alliance. But DARPA, a weapons funding outfit, refused to fund him because his work was too dangerous? Too dangerous? The USDA funded it!
No way is that true. DARPA refused because if they had openly funded Peter Daszak, then his exploits would have looked like what they were - bioweapon production.
What happened here was that the regular government departments funded him until he had a shot at a serious weapon. At that point he of course went to DARPA, because he knew his product had genocidal capability. DARPA saw that the potential was too great for overt funding. So they sent him down the covert funding route. That way they could pretend it was NOT a weapon. If DARPA had overtly funded it, we would all know that it was a bioweapon. WHICH IT IS.
As a final piece of evidence I must point out that Fort Detrick in Maryland is the centre of US bio weapons production.
On August 7th, 2019, its deadly germ research operations were abruptly shutdown
following serious safety violations, in particular relating to the disposal of
dangerous materials - https://en.wikipedia.org/wiki/Fort_Detrick
The CDC issued a Cease and Desist to Fort Detrick on 2019July15. The lab put all
research on hold on August2 and was shut down on 2019August7 according to
Fredericknewspost.com reported by Heather Mongilio - https://madisonarealymesupportgroup.com/2019/08/07/fort-detrick-lab-shut-down-after-failed-safety-inspection-all-research-halted-indefinitely/
https://www.military.com/daily-news/2019/11/24/cdc-inspection-findings-reveal-more-about-fort-detrick-research-suspension.html
The lab reopened partially in late November 2019 and fully reopened in April
2020. The Link has now been changed, the article has been suppressed.
https://www.fredericknewspost.com/news/health/fort-detrick-lab-shut-down-after-failed-safety-inspection-all-research-halted-indefinitely/article_767f3459-59c2-510f-9067-bb215db4396d.html
Link does not work for EU people any more. It worked when it was first
posted!
Research into deadly viruses and biological weapons at US army lab shut down over fears they could escape. Fort Detrick researchers banned from working with anthrax, Ebola and smallpox until procedures improved - https://www.independent.co.uk/news/world/americas/virus-biological-us-army-weapons-fort-detrick-leak-ebola-anthrax-smallpox-ricin-a9042641.html
So the main US bioweapons facility was conveniently out of action for the entire period that Covid-19 was appearing in Italian sewers in 2019September and in the 10 Wuhan hospitals in 2019October. What a coincidence that is! How often was Fort Detrick closed down prior to that, I wonder? It is quite amazing that whilst the entire world was debating whether or not there was a lab leak in Wuhan, the Chinese bioweapons lab, the US bioweapons lab in Maryland was actually closed down due to fear of a lab leak!
Once one understands that the entire pandemic and vaccination response was as US deep state (intelligence) operation, then everything makes sense. Moderna, the NIH, the NIAID, are all playing their role in a scheme designed to do to your genetics what Google has already done to your search results and what Microsoft and Apple have done to your computers and mobile phones and what Facebook, Twitter and Instagram have done to your social life. They have all become US Intel assets. The security services, through these global corporations, have become more powerful than the governments of the world. That is the real constitutional problem for every democracy. And even our democracies are controlled by electronic vote counting machines provided by global corporations.
Do you think that these intelligence agencies would do all the work necessary to control the media, and all the work necessary to control pharmaceutical regulation and all the work necessary to control your search results and your computers and your mobile phones and your online social life. But fail to do the work necessary to control the vote counting machines in every democracy? Is there such a thing as a 50% control freak?